SchoolTrainer Public Page of Solved Homework Problems

For Grade 12
 

146. Block 2 (mass 1kg) is at rest on a frictionless surface and touching the end of an unstretched spring of spring constant 200N/m. The other end of the spring is fixed to the wall. Block 1(mass 1kg) travels at a speed of 4m/s collides with block 2and the two stick together. What distance is the spring compressed when the blocks momentarily stops.

 

120. use a half angle identity to find the exact value- sin(75 degrees)

 

127. What is law of motion?

 

130. What is the difference between monopoly and monopolistic market?

 

138. Please help me on this below question:- A rope having a total mass of 0.4kg and total length 4m has 0.6m of the rope hanging vertically down off a work bench. How much work must be done to place all the rope on the bench?

 

139. Please help on this question:- A particle is trapped in an infinite one-dimensional well of width 0.132nm. The electron is in the n=10 state. A) What is energy of the electron? B) What is the uncertainty in its momentum?

 

140. Please help Find the critical numbers of f (x) = x^2-6x. Find also the open intervals on which the function is increasing or decreasing and locate all relative extrema.

 

147. A 6500-kg helicopter accelerates upward at 0.60 m/s^2 while lifting a 1200-kg car. (a) What is the lift force exerted by the air on the rotors? (b) What is the tension in the cable (ignore its mass) that connects the car to the helicopter?

 

148. Could you please explain me the law of reflection?

 

149. What is linear equation?

 

230. solve the triangle. round angle measures to the nearest minute and side measures to the nearest tenth. a=11.4, b=13.7, c=12.2

 

311. find the greates common factor of 98, 182, 637

 

337. cos2x=0.32

 

351. Using the quadratic equation formula, kindly solve: x2 - 5x = 14

 

361. What is the largest amount of postage that cannot be made using these stamp denominations: 17 cents, 9 cents and 5 cents? Within reason, so not a million dolalrs.

 

393. sketch the graph of the conic. identify center, vertices, foci and asymptotes. (a) x^2-2x+8y+9=0 (b) 16x^2+9y^2-32x+72y+16=0

 

405. If G(x)=x^2+1 find and simplify G(x+h)-G(x)/h

 

462. A businessweek borth america subscribe study collected date from a sample of 2861 subscribers. Fifty nine percent of the respondent indicate an annual income of 75,000 or more and 50% reported having an American Express Credit card. a) What is a population of interest? b) is annual income a qualitative or Quantative Variable? c) Is ownership of an american express credit card quantative or a qualitative variable?

 

463. The ritz carlton hotel used a customer opinion questionare to obtain performing data about its dining and entertainment services. Customers were asked to rate six factors: Welcome, Service, food, menu, appeal, atmosphere and overall experience. Data were recorede for each factor 1 for fair 2 for average and 3 for good and 4 for excellent a) The customers response provided data for six variables. Are the variables quantative or qualitative? b) What measurement of scale if used?

 

464. Nielsen media research condcts weekely surveys of television viewing throughtout the US,publishing both rating and market share date, The Nielsen ratings is the percentage of household with television watching a program, while the Nielsen share is the percentage of household watching a program among those household with televisions in use. For example, Nielsen media research result for the 2003 baseball world series between new york yankees and the flordia marlins showing a rating of 12.8% and a share of 22%. Thus 12.8% of household with television in use were watching the world series. Based on the rating and share data for major television programs, Nielsen publish a weekelt ranking of television programs as well as a weekely ranking of the four major networks: ABC, CBS, NBC and fox.

 

471. An automobile runs the first third part of the road with approximately speed v1, the second third part with approximately speed v2, and the last one with approximately speed v3. What is its approximate speed for the wholeroad run?

 

476. Simplify: 77(sqrt 5x^3)-27(5x^3)

 

514. -3k/2+(9k-5)/6=(11k+8)/k I need to solve for k.

 

530. why would an anthropologist be interested in the issue of poverty and the debates surrounding it? How would they approach the issue, and what further information might they want to explore? And also why would a sociologist be interested in the issue of poverty and the debates surrounding it? How would they approach the issue and what further information might they want to explore?

 

545. A farmer has to use 100% of his land to farm under the following constraints Corn 45-50% Soybean 25-30% Wheat 22.5-27.5% Determine the feasible region?

 

559. A farmer wants to get subsidies from the U.S. government. The government requires hat the farmer use his land to grow the following crops: corn, soybean, and wheat according to the following percentages: Corn 45-50% Soybeans 25-30% Wheat 22.5-27.5% Plot a graph of the feasible region from this data, finding all six corner points.

559. A farmer wants to get subsidies from the U.S. government. The government requires hat the farmer use his land to grow the following crops: corn, soybean, and wheat according to the following percentages: Corn 45-50% Soybeans 25-30% Wheat 22.5-27.5% Plot a graph of the feasible region from this data, finding all six corner points.

 

565. 1. Look at the two monomials below. 54u2v2w3 30u3vw4 What is the least common multiple (LCM) of the monomials shown above? 270u3v2w4 6u2vw3 6u3v2w4 270u2vw3

 

634. indefinite integral of sqrt(3-2x)dx

 

647. mr.k bought a sign that is 48 inches tall.attached by a hinge to each top corner is a support leg of 46.5 inches . sign is raised to a 70 degree angle.find obtuse angle formed between the signs support lag and ground

 

720. the derivative of (e^x - e^3x)^2

 

721. The owner of a retail lumber store wants to construct a fence to enclose an outdoor storage area adjacent to the store, using all of the store as a part of one side of the area. Find the dimensions that will enclose the largest area if 400 feet of fencing materials are used

 

728. A 9.2 m ladder whose weight is 278 N is placed against a smooth vertical wall. A person whose weight is 956 N stands on the ladder a distance 4 m up the ladder. The foot of the ladder rests on the floor 3.22 m from the wall. Calculate the force exerted by the wall. Answer in units of N.

 

768. The Double Ferris wheel has a 15-meter rotating arm attached at its center to a 25-meter main support. At the end of the rotating arm(hub) is attached a second Ferris wheel measuring 20-meters in diameter, rotating counterclockwise direction. The rotating arm takes 6 minutes to complete one revolution, and the wheel connected to the hub takes 4 minutes to complete one revolution about the main wheel's hub. The center of the coordinates system for the Double Ferris wheel is located at the base of the main support. At time t=0, the rotating arm is parallel to the ground and your seat is at the 3 o'clock position. 1. Develop a formula for the vertical position on the chair above the ground as a function of time. Fully explain your reasoning. 2. Develop a formula for the horizontal position on the chair relative to the main support as a function of time. Fully explain your reasoning.

 

771. Verify that the function satisfies the hypotheses of the Mean Value Theorem on the given interval. Then find all numbers \"c\" that satisfy the conclusion of the Mean Value Theorem. f(x)=3x^2 + 2x + 5

 

806. Show that the circumference of the unit circle is equal to 2*2* (Integral [-1,1] SqRoot (1-x^2)] dx)

 

826. suppose a beam of 5ev strikes a potential energy barrier of height 6ev and thickness 7nm at a rate equivalent to a current of 1000A. How long would you have to wait on average for one proton to be transmitted?

 

836. What method would you use to integrate a factored expression, of a degree greater than 1, when there are no coefficients to work with? For example, how would you find the indefinite integral of (x^2 - 1)^3? Is there a way to solve it without manually expanding the brackets?

 

837. in triangle ABC, measurement angle A= 48 degrees and measurement angle c=66 degree what type of traingle is ABC

 

852. let the random variable X represent the weight of male black bears before they begin hibernation. research has shown that X is approximately normally distributed with a mean of 250 pounds and a standard deviation of 50 pounds. what is P(X>325 pounds)?

 

885. Use the definition of derivative to find f(x)=1-x^2

 

941. a right triangle has a hypotenuse of length 20 and a leg of length 12. what is the length of the other leg?

 

945. Solve the equation 1=1/1-a + a/a-1

 

987. how to find the volume of a curve that has the equation... f(y)= -1+the squareroot of 16-y and has endpoints of 0 and 15

 

1051. a right triangle is to be constructed as that the sum of the lengths of the legs x=ab and y=bc is 10 inches. what should x and y be to minimize the length of the hypotenuse ac?

 

1068. power rule explanation of 2 square root x^3

 

1089. the moon is about 381,000 kilometers from the Earth, If the angle subtended by the diameter of the moon on the surface of the earth is 0.0092 radians, approximately what is the diameter of the moon to the nearest hundred kilometers?.

 

1118. if 8% is compounded semiannually what is the rate per compound

 

1143. find the rate of change of the distance between the origin and a moving point on the graph of y=x squared + 1 if dx/dt = 2 centimeters per second

 

1150. help me solve this, solve the system equations by graphing (x+y=2 and y-x=2)

 

1183. Interest rate is 9 % and doubling time is 8 years. If you invest $5,000.00, what will it grow to in 24 years?

 

1186. The sum of two positive numbers is 20. Find two numbers such that: a) THe sum of the squares is a minimum. b) the product of one and the square of another is a maximum. c) the product of the square of one adn the cube of the other is a maximum.

 

1205. Water is pumped into an empty tank at a rate of r(t)=20e^0.002t gallons per minute. Approximately how many gallons of water have been pumped into the tank in the first five minutes?

 

1213. x/ x^2+5x+6 - 2/x^2+3x+2

 

1226. solve the system of equations by elimination 7x-5y = 2 7x-5y =-5

 

1254. Write an equation fot the tangent line of the curve -2y^3+5xy=-2x+12 at the point where y=1.

 

1275. I have been assigned two different HC2H3O2 solution concentrations and two different Na2CO3 solution concentrations by my teacher. Acetic Acid: 0.0800M and 0.160M Carbonate Ion: 0.100M and 0.140M Determine the volume, in mL, of 2.00M HC2H3O2 required to prepare each and the mass of sodium carbonate to prepare each.

 

1294. 1. Given the Price Demand equation p+0.01x = 50 (a) Express the Demand x as a function of the price p. (b) Find the elasticity of demand, E(p). (c) What should the company charge for the camera, and how many cameras should be produced to realize the maximum weekly profit?

 

1298. Find the volume if the area bounded by the curve y=x^3+1, the x axis are x=0 and x=3 is is rotated around the x-axis

 

1361. Use an Euler diagram to determine whether the syllogism is valid or invalid. 1. Some policemen are polite. 2. Jarod Harshbarger is a policeman. 3. Jarod Harshbarger is not polite.

 

1344. Write an explanation of how you could use Descartes rule and the Fundamental Theorem to predict the number of complex roots to a polynomial. Please include at least two examples to help clarify your explanation.

 

1351. what percentage of people in the united states rate themselves as very happy?

 

1352. How do you change an equation that has respect to x to have respect to y?

 

1353. in 2003 the population of baytown was 4739 the population goes up 4% every year. What is the population of Baytown for each year from 2004 to 2008

 

1354. If you have a cuboid with lengh and width as x and height as y and there is a piece of string around like when you put ribbon around a box, minus the bow. what is the length of the string L in terms of x and fixed volume in the format L=ax+b/x^2

 

1363. Teresa and Julia are among 10 students who have applied for a trip to Washington, D.C. Two students from the group will be selected at random for the trip. What is the probability that Teresa and Julia will be the 2 students selected?

 

1371. 2+2^2 over 3 + 2^3 over 3^2+....... + 2^n+1 over 3^n. Express each sum using summation notation.

 

1387. I need help solving a math problem. its about half-angle identities. it says find the exact value using the half-angle identities. its Cos (pie)/8

 

1395. Given an array of size 100 called numbers, write a code segment that would find the largest element in the array. You can assume that the array has already been initialized to hold values

 

1408. The half-life of the radium isotope Ra 226 is approximately 1,599 years. What percent of a given amount remains after 100 years?

 

1410. Ahmed is posting 2 photographs on his website. He has narrowed his choices to 4 landscape photographs and 3 portraits. If he chooses the two photographs at random, find the probability of each selection.

 

1415. Given the functions g(x)=sqroot x and h(x)=x+1 , determine all possible values of x for which h(g(x))=g(h(x)) .

 

1426. help me solve this problem...6(x+4)^2=30

 

1433. Check all the answers that represent the same level of precision. A. 1.045 B. 0.59 C. 98.42 D. 100.6

 

1439. If 17.5 mL of 0.50 N HCl are needed to titrate 35.0 mL of NaOH to the endpoint, what is the % concentration of the NaOH in the sample?

 

1455. Implicitly differentiate the equation to find dy/dx x^3+y^3= 2x^2y^2+1

 

1468. A room is 13 ft. It needs to be painted. The ceiling is 8 ft above the floor. there are two windows int he room, each one is 3 ft by 4 ft. The door is 2.5 ft by 6.5 ft. What is the area of the wall and ceiling? 1 gallon of paint covers 64.37sq ft. How many gallons are needed to paint the room? At $23.48 a gallon, what is the cost to paint the room?

 

1478. Suppose you want to make a scale model of a hydrogen atom. You choose for the nucleus a small ball bearing with a radius of 2mm.The radius of the hydrogen atom is 0.529x10^-10 m and the radius of the nucleus is 1.2 x 10^-15m. What would the radius of the model be in m? Suppose that you now want to make a scale model of the solar system using the same ball bearing to represent the sun. How far from it in mm would you place a sphere representing the earth? (Earth is 1.496 x 10^11m from the sun) (center to center distance) And, what would be the radius (mm) of the sphere representing the earth?

 

1496. The supermarket tabloids report that a person fell 130ft from a bldg. He landed on a ventilator box which was crushed 18.7 in. Use a coordinate system with down being + to answer. What is his speed (m/s) before colliding with the box? What is his acceleration (m/s/s) while crushing the box (assume constant acc.)? How long did it take (ms) for him to come to a stop after first contacting the box?

 

1507. given: f(x)=x^4-3x^3+2x^2-7x-11 find all roots to the nearest 0.001

 

1508. A rancher sits on a tree limb and drops vertically onto a galloping horse under the tree. The speed of the horse in 9.28m/s and the distance from the limb to the saddle is 3.23m. What must be the horizontal distance in m between the saddle and the limb when the rancher drops and how long (s) is he in the air?

 

1519. Does the Electoral College provide the United States with more benefits or more costs?

 

1536. evaluate arccot(1/sqrt3)

 

1541. A bag has total 40 coins of 1,2 and 5 unit denominations. If total amount value of coins is 140 then find the number of coins.

 

1565. 2 marbles are drawn from a bag contaning 6 white, 4 red, and 6 green marbles. Find the probability of both marbles being white.

 

1575. Air is being pumped into a spherical balloon at a rate of 5cm^3/min. Determine the rate at which the radius of the balloon is increasing when the diameter is 18cm.

 

1583. CACAGCACCCCAGCACGACAAAGGGCCCCC I need to write the 10 amino acid long sequence that this strand of DNA codes for, as shown above. I have to use three letter code for amino acid sequence.

 

1596. Help me solve this alegbra problem: ((1)/(x-5)) +10=((x)/(x-5))

 

1643. write a general linear equation for the line that passes through the points (1,1) and (2,1).

 

1713. let f(x)=(2x-pi) ^3 +2x-cosx. the value of modulus of d/dx of f inverse of x when x= pi is

 

1722. X^3 - x^2 lessthan equal to 1

 

1738. Solve for x (x-7)^4/3=1

 

1741. Prove that the equation has at least one real root and use your calculator to find an interval of length .01 that contains a root. E^x=2-x

 

1752. The diagram shows the gears of a bicycle. AD = 5 inches, and BC = 3 inches. CD, the length of the chain between the gears, is 17 inches. What type of quadrilateral is CDEB?

 

1763. Determine whether the function f(x)=-x^2-4x+4 has a maximum and minimum

 

1782. 2/3 of 1/6 of 3/4 of a number is 12

 

1788. (x+7)(x-1)=(x+1)^2 how to solve

 

1843. Identify the center and radius -6x+y^2=-x^2-146+2y(square root of 141)

 

1840. The line through (-10, 2) which is perpendicular to the line y=8x+9 has slope -1/8 and a y-intercept __?

 

1850. (2+x)^2-8/x

 

1873. what is 3[f(x+2)] if f(x)=x^3+2x^2-4?

 

1947. If x^2 y^2=2, find an expression for y.

 

1967. Help me solve this math problem: 5/x-3 - 2/x^2-9

 

1972. lim (3x+2)/(4x) as x approaches infinity

 

1982. Lim approaches infinity. The square root of x+9-3, all divided by x

 

1985. how to prove that the integral (lnx)^n [eval @ 0 to 1] equal (-1)^n*!

 

2008. x^2+x-20>0 I need help find solution set for the linear inequalities.

 

2010. If the manager of a store adds 50 lamps to its current inventory, the resulting total number of lamps will be the same as three-halves of the current inventory. if the manager wanted to increase the current inventory by 40%, what would his new inventory of lamps be ?

 

2017. differentiate y=2x/1-3x^2

 

2027. 4^(x^2-10x+25)=1

2027. 4^(x^2-10x+25)=1

 

2074. Les drives 4 miles each way to work at an average of $0.195 per mile. He pays $2.25 a day to park and works an average of 24 days per month. What is his average monthly cost?

 

2081. What is the period that corresponds to a frequency of 53.1 Hz? Answer in units of s

 

2091. If the line 3x-4y=0 is tangent in the first quadrant to the curve y=x^3+k, then k is

 

2092. The derivitive of (x)times the square root of (x^2 +1)

 

2097. My question is Evaluate limit of x as it approaches 2,x^1560-2^1560 divided by x-2, using the defintion of the derivative for an appropriate function

 

2115. How to do rational equations and radical equations

 

2133. Help me understand this Calculus problem: When an object is placed at a distance p from a convex lens having focal length 6 cms, then the image will be at a distance q from the lens while 1/6=1/p+1/q. Find the rate of change of p with respect to q.

 

2145. Find the root of X^2-19x-42

 

2292. How many grams of calcium flouride are in 800mL of a 0.62 M calcium flouride solution?

 

2317. find a polynomial of degree n that has the given zeros x=-2,4,7 n=3

 

2382. A particle moving along the curve 16x^2+9y^2=144 find all points which the rate of change of y and x are equal. Assure these rates are never both zero at the same time

 

2409. Help me find all open intervals on which the function f(x) = x to the second power over x to the second power plus 4

 

2489. Need help performing a statistical hypothesis test

 

2530. A candy manufacturer of chocolates make small chocolates wrapped in a layer of a cany to a thickness of 1 mm. Every little chocolate is made with 2.5 g of chocolate and is one of the forms described below- 1.Cylinder circular 1 cm in diameter 2.Cube 3. Bowl Here is some informations about the chocolate and wrapping: - 1 mL of chocolate weighs 0.8 g and occupies a volume of 1 cm3. - The manufacturer of chocolates has 1000 kg of chocolate. - It cost to the manufacturer $2,50 to buy 1 L of candy for wrapping. a) How many chocolates manufacturer of chocolates can make? b) What quantity of candies is used to wrap a small chocolate shaped in : 1) Cylinder? 2) Cube? 3) Ball? c) How much money it saves the manufacturer of chocolates by making small chocolates in the shape of a ball rather than the form of: 1) cylinder? 2) cube?

 

2561. y==200sin(6t-1.2)mm where the angles are in radians. What is the period of oscillation? The initial value of y (when t=0) and the value of t at which y reaches 50mm?

 

2566. (5.9x^3+3.4^2-7)-(2.9x^3-9.6x^2+3)

 

2593. A fair coin is tossed five times. Find the probability of obtaining one head and three tails.

 

2595. What is the trend of subsequent ionization energies on the periodic table? Are there irregularities in the pattern? explain

 

2622. . Suppose the spot and three-month forward rates for the yen are 128.49 and 132.82, respectively. (a) The yen is expected to get weaker (b)Based on the information given, the inflation difference between the U.S. and Japan is approximately --------------------------percent annually. (Do not include the percent sign (%). Round your answer to 2 decimal places, (e.g., 32.16))

 

2639. explain me how to use multinomial theorem in detail in the chapter permutations and combinations(how diff questions can be solved by it?)

 

2647. write a program in c++ that will print the multiplication table of any number (upto any number).

 

2714. FIND THE SUM in normalised floating print representation 0.215642E04 + 0.146521E05 + 0.233416E06

2714. FIND THE SUM in normalised floating print representation 0.215642E04 + 0.146521E05 + 0.233416E06

2714. FIND THE SUM in normalised floating print representation 0.215642E04 + 0.146521E05 + 0.233416E06

2714. FIND THE SUM in normalised floating print representation 0.215642E04 + 0.146521E05 + 0.233416E06

 

2720. y=x2 how to find tangent line with points (-4,16)

 

2725. According to the Current Population Survey of the Census Bureau, 67% of children live with both parents, 23% live with their mother only, and 5% live with their father only. The rest live with neither parent. If we choose a child at random, what is the probability that the child lives with only ONE parent (father OR mother)?

 

2734. Traffic flow is defined as the rate at which cars pass through an intersection, measured in cars per minute. The traffic flow at a particular intersection is modeled by the function F... F(t)= 82 + 4sin(t/2) for 0 < t < 30... A) to the nearest whole number, how many cars pass through the intersection over the 30 min period? b) is the traffic flow increasing or decreasing at t=7 c) what is the average value of the traffic flow over the time interval 10 < t < 15? d) what is the avg rate of change of the traffic flow over the time interval 10 < t <15?

 

2745. Find the slope of the tangent on this curve? y=x^2-3x at the point (2, -2) Using the formula m= lim h->0 = [f(x+h)-f(x)]/h

 

2765. Please help find sin2x for secx = -5, for pi < x < 3pi/2

 

2769. If m<1 + m<5 = 100 Find the measure of m<8

 

2781. Find the area of a circle with radius 19.4 m to the nearest tenth. Use 3.14 for Pi.

 

2820. You invest 5000 in an account which pays interest compounded continuously. If you want the account to contain 8000 after 6 years, what yearly interest rate is needed? Round your answer to one decimal place.

 

2829. Find the lim as x aproaches delta (D) x of: (x+Dx)^2-2(X+Dx)-(X^2-2x)?

 

2830. how does the ionoshpere help in the transmission of radio waves?

 

2907. For a sample of measurements x-bar = 10m, median = 13m standard deviation = 4m and sample variance = 16m^2 a) if the data is changed to centimeters (i.e. yi=100xi) then find the new set of measurements Here, I just multiplied all of the above answers by 100, and assumed that that was correct BUT, if I use that logic for part b, it starts to get confusing... b) IF the data is transformed to yi=(xi-10)/4 find the new measurements ... if I try to do the same thing (sub the x measurements into the new formula) I end up with an average length of 0, which makes no sense to me, and makes me think that I must be doing something wrong!

 

2914. 4(negative3x+1)=negative10(x-4)-14x

 

2923. The Oliver Company plans to market a new product. Based on its market studies, Oliver estimates that it can sell up to 4,600 units in 2005. The selling price will be $2 per unit. Variable costs are estimated to be 20% of total revenue. Fixed costs are estimated to be $6,600 for 2005. How many units should the company sell to break even?

 

2938. (inverse sin) sin power -1 (-1/2) exact value

 

2942. How do i prove that the product of 2sin(k\pi / n) = n from k=1 to k=n-1 Background knowledge: I am investigating roots of unity. So the equation z^n-1=0. I am especially interested in the distance between roots. The distances between roots from root 1 (which is common for all n) is given by 2sin(k\pi/n). I then found when multiplying all distances it equals to n! I need to prove this somehow! I have been working with factorization a little bit to try and see what i could come up with. For z=3 i have (z-1)(z^2-z(2cos(2\pi/3)+1) and for z=4 i have (z-1)(z+1)(z^2-z(2cos/\pi/2)+1).. i wonder if this has something to do with it!

 

2956. 75.00 mL of.1350M perchloric acid is titrated with .3375 M HCL. Calculate the Ph of the resulting solution assuming the volumes are additive when 10.0mL of base are added......I am not sure how to set up this problem or any like it

 

3008. What is integration?

 

3057. what is a good thesis for welfare from an economic perspective?

 

3095. Three freshmen and three sophomores are to be seated in a row. Find the number of seating arrangements if the freshmen are on the left and the sophmores are on the right.

 

3115. I need help simplifying the expression 1-2cos^2x+cos^4x

 

3122. 9x^2+36x+y^2-6y+9=0 help solve please

 

3156. Write the equation of the circle that has a center at the origin and is tangent to the line with the equation 3x - 4y = 10?

 

3161. Help me solve this problem csc*cos^2/1+csc

 

3193. How do I factor: sec^4x+sec^2xtan^2x-2tan^4x?

 

3215. help me solve this math problem: determine whethe the mean value theorem can be applied to the function f(x)=2sinx+sin2x on the closed interval [8pi,9pi].

 

3207. find the exact value: (tan 325 - tan 25)/(1+ tan325tan25)

 

3236. a) Research the space elevator and describe how the rotation of the earth prevents the cable from falling to its attachment point at the earth's equator. b) Consider the environment in which the cable must operate. Recommend two physical, and one chemical property that the cable should have. Justify your choices. c) Based on what you have learned about bonding in solids, which type of solid, in your opinion, is the most suitable for use in the space elevator cable? Justify your choice. d) Research which technical hurdles must be overcome before your choice in (c) can be used for the elevator cable.

 

3249. The product of two positive numbers is 588. Minimize the sum of the first and three times the second.

 

3271. The length of a rectangle sign is 3 feet longer than the width. If the sign area is 54 square feet, find it length and width.

 

3276. Two players play the following game. Each alternately chooses a number between 1 and 10. The player who makes the sum of the numbers chosen by both add to 100 wins. Analyze the game.

 

3320. Suppose that f is a linear function with slope 2.4 and that f(7)=-3. What value of x gives f(x)=0?

 

3321. what is a black hole?

 

3360. A particle moves up and down the y-axis with velocity v feet per second given by v=t3 -7t2 +15t - 9 during the time interval [0,4]. At time t=0, its position is y=4. At what time(s) is the particle stopped? At what time is is the velocity the absolute maximum? The absolute minimum? At what time(s) does the velocity-time graph have a point of inflection> What is happening to the particle at the point(s) of inflection? Find the position, y, as a function of time. At what time is the position the absolute maximum? The absolute minimum? At what time(s) does the position-time graph have a point of inflection? What is happening to the particle at the point(s) on inflection? Is y ever negative? (explain) What is the net displacement of the particle from t=0 to t=4? How far does the particle travel from t=0 to t=4? What is the average velocity from t=0 to t=4? What is the average speed from t=0 to t=4?

 

3370. determine an equation of the line tangent to the graph of f at (a,f(a) for the given value of a. F(x)=x^3 a=-1

 

3379. Test for convergence or divergence using the geometric series test for the sum of 5(-1/5)^n from n=0 to infinity.

 

3386. There are 5 different scented candles, each pack has 3 candles.each candle has 5 possible scents. scents can be repeated. how many packs are possible? what is the probability that all 3 candles in a given pack would have the same scent? if a store receives 200 packs, how many packs would contain 3 of the same scent. of the 200 packs there were actually 6 packs each with 3 candles of the same scent. does this mean the computer was not randomly choosing the scents?

 

3387. If a package of lables costs $25.00 and there are 1250 lables in the package, how much would 20 lables cost?

 

3427. A light string of length a is attached to two points A and B on the same level and distance b apart, where b < a. A smooth ring of weight W is threaded on the string and is pulled by a horizontal force P, so that it rests in equilbrium vertically below B. Show that tension in the strings is W(a^2 + b^2)/2a^2 and find the force P

 

3446. Together, two workers can complete a job in 8 hours. The first worker can complete the job 4 times faster than the second worker. How long would it take the faster worker to do the job alone?

 

3473. THE DISSOCIATION OF AMMONIA AT 400 DEGREES CELCIUS HASA kC VALUE OF 1.92. NH3(G) <--> N2(G) + H2(G) IF 0.700 ML OF AMMONIA WAS PLACED IN A 500Ml CONTAINER DETERMINE THE EQUIIBRIUM CONCENTRATIONS OF ALL THE GASES.

 

3478. It was proven during the previous lecture that 1+2+3+....+n=[n(n+1)]/2. Using that result, find the sum of all 3-digit palindromes: a palindrome is a number that can be written as ABA, where 1=

 

3502. divide f(x) by d(x) in polynomial form and fraction form if f(x)=x2-2x+3; d(x)=x-1

 

3506. you roll two fair dice, a green one and a read one. 1.are the outcomes on the dice independent? 2.find the P(1 on a green dice and 2 on red dice) 3. find p(3 on green dice and 5 on red dice) 4. find p(3 on green dice and 5 on red dice) or (2 on green dice and 1 on red one)

 

3517. The whole is 5000 and the part is 10. Find the percent.

 

3562. find an equation for the hyperbola vertices (3,0),(3,4) asymptotes:y=2/3,y=4-2/3x

 

3596. A commercial jet is flying from Miami to Seattle. The jet's velocity with respect to the air is 580 miles/hour and its bearing is 332 degrees. The wind, at the altitude of the plane is blowing from the southwest with a velocity of 60 miles/hour. a) Draw a figure that gives a visual representation of the situation. b) Write the velocity of the wind as a vector in component form. c) Write the velocity of the jet relative to the air in component form. d) What is the speed of the jet with respect to the ground? e) What is the true direction of the jet?

 

3617. Intergration Problem: d/dx (1-3x to 1 u^3/1+u^2 du )

 

3622. Draw a Venn diagram that includes regions that show these 6 classes of numbers and the overlaps among them : * Odd numbers *2-digit numbers *3 dight numbers *intergers *rational numbers *perfect squares (like 100, which is 10*10 ) place the following 13 numbers on your venn diagram in their correct places: 3/4, 15,28,36,81,363,441,484,500,1369,2500,5000,7777

 

3627. Help me understand this precalculus problem cos^2A (sec^2A-1)

 

3647. consider the differential equation dy/dx=2x-y. Find (dy)^(2)/(dx)^(2) in terms of x and y.

 

3676. help me solve this math problem 59n over 99 times 80 over 33n

 

3710. This is about Computer Science. I need help with this homework assignment. Can you please help me?? A hiking trail has elevation markers posted at regular intervals along the trail. Elevation information about a trail can be stored in an array, where each element in the array represents the elevation at a marker. The elevation at the first marker will be stored at array index 0, the elevation at the second marker will be stored at array index 1, and so forth. Elevations between markers are ignored in this question. public class Trail { private int [ ] markers; public boolean isLevelTrailSegment (int start, int end) { /*to be implemented in part a */ } pubic boolean isDifficult ( ) { /*to be implemented in part b */ } a. Write the Trail method "isLevelTrailSegment". A trail segment is defined by a starting marker, and ending marker, and all markers between those two markers. The parameters of the method are the index of the starting marker and the index of the ending marker. The method will return "true" if the difference between the maximum elevation and the minimum elevation in the trail segment is less than or equal to 10 meters. For the trail shown at the beginning of the question, the trail segment starting at marker 7 and ending at marker 10 has elevation ranging between 70 and 80 meters. Because the difference between 80 and 70 is equal to 10, the trail segment is considered level.

 

3714. why is the fangtooth fish important?

 

3718. 10h=8h+6 solve and check

 

3801. I need some help with showing exponential growth on a graph and some other functions

 

3816. In order to fence in the outfield of a softball field, the length of the fence is needed. The fence should be 175 feet down the right and left fields and 185 to center field. How much fence is needed?

 

3843. Find the annual amount of FICA at a 7.51% rate by computing his annual salary. Sam Takagi Weekly salary: $435.16 (Not self-employed). Find the annual amount of FICA by computing his annual salary. (options: $169,938.68 $16,993.87 $1,699.39)

 

3847. help me solve this problem p(x)= 1/8(2x4+3x3-16x-24)2

 

3851. Combine like terms. 5b + 7 + 7b - 6

 

3852. The sum of the first n terms of a GP is 2^(n+1). Find the first term and the common ratio.

 

3972. A rectangle with an area of 800 sqft is enclosed in another rectangle with dimensions of 80ft x 60 ft. Each side of the inside rectangle is the same distance away from the outside rectangle. Find the distance from each side of the inside rectangle.

 

4029. Help me solve this math problem: Find the perimeter of the ice skating rink with the given dimensions. (hint: Think of the rink as made up of 2 half-circles at the top and bottom of the rectangle.) (30m width, and 12m length.) Can you show ur work pls...

 

4074. Consider this data sequence: \\\"fish bird reptile reptile bird bird bird mammal fish\\\". There is a CONSECUTIVE REPETITION of length 3 (the three consecutive birds) and a CONSECUTIVE REPETITION of length 2 (the two reptiles). There are also several SINGLETONs of length 1 (a singleton fish, a singleton bird, a singleton mammal, and another singleton fish). Write some code that uses a loop to reads in a sequence of words, terminated by the \\\"xxxxx\\\". The code assigns to t the number of CONSECUTIVE REPETITIONS that were read. (For example, in the above data sequence that value would be 2.) Assume that t has already been declared but not initialized. Assume that there will be at least one word before the terminating \\\"xxxxx\\\".

4074. Consider this data sequence: \\\"fish bird reptile reptile bird bird bird mammal fish\\\". There is a CONSECUTIVE REPETITION of length 3 (the three consecutive birds) and a CONSECUTIVE REPETITION of length 2 (the two reptiles). There are also several SINGLETONs of length 1 (a singleton fish, a singleton bird, a singleton mammal, and another singleton fish). Write some code that uses a loop to reads in a sequence of words, terminated by the \\\"xxxxx\\\". The code assigns to t the number of CONSECUTIVE REPETITIONS that were read. (For example, in the above data sequence that value would be 2.) Assume that t has already been declared but not initialized. Assume that there will be at least one word before the terminating \\\"xxxxx\\\".

 

4090. why are alkenes and alkynes considered to be unsaturated hydrocarbons and not saturated?

 

4116. 15/x-1=24/2x

 

4143. Literature-Find passages in Ethan Frome in which the words relate to the cold and explain in details please.

 

4299. help me understand history question identify the revolutionary governments and their achievements and failures

 

4427. which is more dangerous alternating current or direct current

 

4399. Graph: 5-2(x-6)^(1/3), for x doesnt equal 5 the limit of f(x) as x approaches 5 is equal to 7. write the definition of limit as it applies to f at this point.

 

4430. A study is conducted to determine if any damage and if so, to the extent of the damage, to the brains of three groups of people who have had high blood pressure for either 5 years, 10 years or 15 years. This study is an example of ________ research. a)basic b)applied c)ethical d)unethical

 

4459. A particular brand of anti spam software claims the software accidentally sends valid emails about 15% of the time to a spam folder. A company randomly examines the emails in the spam folder. The company wants to estimate the percent of emails that are valid. RAND#Line: 79849 19352 62726 46569 35421 14141 06122 58761 43239 99416 06260

 

4478. during the routine analysis of cool tar, a by product of the production of coke from coal, a colorless, oily liquid was isolated. analysis reveled that it contained only carbon, hydrogen and nitrogen. when a 0.620g sample of the compound was in burnt in oxygen it produced 1.76g of carbon dioxide. a second sample of the compound of mass 0.232g was decomposed. this produced 29.5ml of nitrogen gas measured at 15 degree Celsius and 101.3kPa pressure. another sample of th ecompound was vapourised and at 100 degrees celsius and 101.3 kPa pressure was found to have a density of 3.04g/L-1. the unknown compound was found to undergo substitution reactions with bromine and exhibit basic properties in aqueous solution. a) determine the empirical formula b) Determine the molecular formula c) Draw the structural formula for the compound

 

4500. correct this sentence. What you do not know, is that your son, Kiowa, has been killed in war.

 

4538. f(x)=3x^2+2x-1,evaluate f(a+h)-f(a)/h

 

4552. Imagine that you are the owner of a small dry-cleaning business that is considering switching from using the "normal" organic solvents to liquid carbon dioxide, as described in the lesson introduction. a)Provide a brief explanation of why carbon dioxide is a suitable solvent to use b)Research two pros and two cons of using liquid carbon dioxide for dry cleaning.

 

4570. A player kicks a football an angle 23 deg to the horizontal with a speed of 12.5m/s. The receiver runs towards the ball at a constant speed to just intercept the ball at ground level. How fast must he run?

 

5127. Review the half-reaction for the reduction of oxygen that occurs with the corrosion of iron to explain why corrosion occurs more slowly in dry climates.

 

5203. Describe the structure of 3 named australian native terrestrial plants that assist in conserving water.

 

5251. Answer the questions below regarding this polynomial: 8x + 2x^4 - 5x^3 1.) This expression, written in standard form, would look like this: 2.) This is a ___degree polynomial. 3.) The leading coefficient of this polynomial is ____ .

 

5292. please explain how to do it also

 

5369. Implicit differentiation of (tan)^3(xy^2+y)=x

 

5348. I have 70ml of a solution, and I spill 40ml of it and add 40ml of distilled water. I take 20ml to tested at a lab to see how much salt was in it, but I need 50 ml to complete the test, so I add 30 ml of water. I find out that the solution I tested had a weight percentage of .500 How do I figure out the ppm (parts per million) of salt in the original solution? Thanks in advance!

 

5352. I am having trouble finding the x intercept. I get the answer wrong. the question is:x^2-y^2+2x-3y+1=7

 

5384. How do I verify this equation?

 

5390. A car is driven 50km west and then 20 km southwest. Using sine and cosine laws, find the displacement (magnitude and direction) of the car from the point of origin? Draw a diagram as well.

 

5408.

 

5507. algebra

 

5544. Use the half-angle formula to simplify the expression: sqrt(1+cos 4x/1-cos 4x)

 

5562. A man standing at a point P on a flat plane starts walking. At eacj step, he walks exactly 1 foot in one of the directions N,S,E or W. Suppose that after 6 steps he comes back to P, then no. of disctinct paths he can take is ?

 

5584. 1. What is the probability that in an arrangement of BUTTERED TOAST the O and A or the E and T are adjacent? 2. When drawing 4 marbles from out of a bag with 8 red and 4 blue, what is the probability that at least one blue and red is pulled? (No replacement) 3. A box has a group of 24 blocks in it. Some are red, some are yellow, and some are a mixture of the two colours. The probability of drawing a block with red on it is 1/3. The probability of drawing a red and yellow block is 1/12. Determine the number of blocks with yellow on them.

 

5586. F(x)=ln(x-4) Domain? Range? Asymptote?

 

5667. How do I reword this research question "Does Creative Commons solve the dilemma of reclaiming fair use within creative works that use copyrighted material?"