Recently Submitted Homework Problems for Following Grade: 12

120. use a half angle identity to find the exact value- sin(75 degrees) (Answered)


127. What is law of motion? (Answered)


139. Please help on this question:-
A particle is trapped in an infinite one-dimensional well of width 0.132nm. The electron is in the n=10 state. A) What is energy of the electron? B) What is the uncertainty in its momentum? (Answered)


140. Please help
Find the critical numbers of f (x) = x^2-6x. Find also the open intervals on which the function is increasing or decreasing and locate all relative extrema. (Answered)


149. What is linear equation? (Answered)


230. solve the triangle. round angle measures to the nearest minute and side measures to the nearest tenth. a=11.4, b=13.7, c=12.2 (Answered)


337. cos2x=0.32 (Answered)


351. Using the quadratic equation formula, kindly solve: x2 - 5x = 14 (Answered)


361. What is the largest amount of postage that cannot be made using these stamp denominations: 17 cents, 9 cents and 5 cents? Within reason, so not a million dolalrs. (Answered)


463. The ritz carlton hotel used a customer opinion questionare to obtain performing data about its dining and entertainment services. Customers were asked to rate six factors: Welcome, Service, food, menu, appeal, atmosphere and overall experience. Data were recorede for each factor 1 for fair 2 for average and 3 for good and 4 for excellent

a) The customers response provided data for six variables. Are the variables quantative or qualitative?

b) What measurement of scale if used?
(Answered)


476. Simplify: 77(sqrt 5x^3)-27(5x^3) (Answered)


559. A farmer wants to get subsidies from the U.S. government. The government requires hat the farmer use his land to grow the following crops: corn, soybean, and wheat according to the following percentages:
Corn 45-50%
Soybeans 25-30%
Wheat 22.5-27.5%

Plot a graph of the feasible region from this data, finding all six corner points. (Answered)


559. A farmer wants to get subsidies from the U.S. government. The government requires hat the farmer use his land to grow the following crops: corn, soybean, and wheat according to the following percentages:
Corn 45-50%
Soybeans 25-30%
Wheat 22.5-27.5%

Plot a graph of the feasible region from this data, finding all six corner points. (Answered)


634. indefinite integral of sqrt(3-2x)dx (Answered)


771. Verify that the function satisfies the hypotheses of the Mean Value Theorem on the given interval. Then find all numbers \"c\" that satisfy the conclusion of the Mean Value Theorem.
f(x)=3x^2 + 2x + 5 (Answered)


806. Show that the circumference of the unit circle is equal to 2*2* (Integral [-1,1] SqRoot (1-x^2)] dx) (Answered)


826. suppose a beam of 5ev strikes a potential energy barrier of height 6ev and thickness 7nm at a rate equivalent to a current of 1000A. How long would you have to wait on average for one proton to be transmitted? (Answered)


852. let the random variable X represent the weight of male black bears before they begin hibernation. research has shown that X is approximately normally distributed with a mean of 250 pounds and a standard deviation of 50 pounds. what is P(X>325 pounds)? (Answered)


852. let the random variable X represent the weight of male black bears before they begin hibernation. research has shown that X is approximately normally distributed with a mean of 250 pounds and a standard deviation of 50 pounds. what is P(X>325 pounds)? (Answered)


1051. a right triangle is to be constructed as that the sum of the lengths of the legs x=ab and y=bc is 10 inches. what should x and y be to minimize the length of the hypotenuse ac? (Answered)


1143. find the rate of change of the distance between the origin and a moving point on the graph of y=x squared + 1 if dx/dt = 2 centimeters per second (Answered)


1150. help me solve this, solve the system equations by graphing (x+y=2 and y-x=2)
(Answered)


1183. Interest rate is 9 % and doubling time is 8 years. If you invest $5,000.00, what will it grow to in 24 years? (Answered)


1186. The sum of two positive numbers is 20. Find two numbers such that: a) THe sum of the squares is a minimum. b) the product of one and the square of another is a maximum. c) the product of the square of one adn the cube of the other is a maximum.
(Answered)


1205. Water is pumped into an empty tank at a rate of r(t)=20e^0.002t gallons per minute. Approximately how many gallons of water have been pumped into the tank in the first five minutes? (Answered)


1254. Write an equation fot the tangent line of the curve -2y^3+5xy=-2x+12 at the point where y=1. (Answered)


1275. I have been assigned two different HC2H3O2 solution concentrations and two different Na2CO3 solution concentrations by my teacher. Acetic Acid: 0.0800M and 0.160M Carbonate Ion: 0.100M and 0.140M Determine the volume, in mL, of 2.00M HC2H3O2 required to prepare each and the mass of sodium carbonate to prepare each.
(Answered)


1294. 1. Given the Price Demand equation p+0.01x = 50


(a) Express the Demand x as a function of the price p.
(b) Find the elasticity of demand, E(p).
(c) What should the company charge for the camera, and how many cameras should be produced to realize the maximum weekly profit?


(Answered)


1298. Find the volume if the area bounded by the curve y=x^3+1, the x axis are x=0 and x=3 is is rotated around the x-axis (Answered)


1344. Write an explanation of how you could use Descartes rule and the Fundamental Theorem to predict the number of complex roots to a polynomial. Please include at least two examples to help clarify your explanation. (Answered)


1351. what percentage of people in the united states rate themselves as very happy? (Answered)


1352. How do you change an equation that has respect to x to have respect to y? (Answered)


1353. in 2003 the population of baytown was 4739 the population goes up 4% every year. What is the population of Baytown for each year from 2004 to 2008 (Answered)


1354. If you have a cuboid with lengh and width as x and height as y and there is a piece of string around like when you put ribbon around a box, minus the bow. what is the length of the string L in terms of x and fixed volume in the format L=ax+b/x^2 (Answered)


1371. 2+2^2 over 3 + 2^3 over 3^2+....... + 2^n+1 over 3^n. Express each sum using summation notation. (Answered)


1387. I need help solving a math problem. its about half-angle identities. it says find the exact value using the half-angle identities. its Cos (pie)/8 (Answered)


1408. The half-life of the radium isotope Ra 226 is approximately 1,599 years. What percent of a given amount remains after 100 years? (Answered)


1410. Ahmed is posting 2 photographs on his website. He has narrowed his choices to 4 landscape photographs and 3 portraits. If he chooses the two photographs at random, find the probability of each selection. (Answered)


1415. Given the functions g(x)=sqroot x and h(x)=x+1 , determine all possible values of x for which h(g(x))=g(h(x)) . (Answered)


1426. help me solve this problem...6(x+4)^2=30 (Answered)


1433. Check all the answers that represent the same level of precision.
A. 1.045
B. 0.59
C. 98.42
D. 100.6
(Answered)


1439. If 17.5 mL of 0.50 N HCl are needed to titrate 35.0 mL of NaOH to the endpoint, what is the % concentration of the NaOH in the sample? (Answered)


1455. Implicitly differentiate the equation to find dy/dx
x^3+y^3= 2x^2y^2+1 (Answered)


1468. A room is 13 ft. It needs to be painted. The ceiling is 8 ft above the floor. there are two windows int he room, each one is 3 ft by 4 ft. The door is 2.5 ft by 6.5 ft. What is the area of the wall and ceiling? 1 gallon of paint covers 64.37sq ft. How many gallons are needed to paint the room? At $23.48 a gallon, what is the cost to paint the room? (Answered)


1478. Suppose you want to make a scale model of a hydrogen atom. You choose for the nucleus a small ball bearing with a radius of 2mm.The radius of the hydrogen atom is 0.529x10^-10 m and the radius of the nucleus is 1.2 x 10^-15m. What would the radius of the model be in m?
Suppose that you now want to make a scale model of the solar system using the same ball bearing to represent the sun. How far from it in mm would you place a sphere representing the earth? (Earth is 1.496 x 10^11m from the sun)
(center to center distance)
And, what would be the radius (mm) of the sphere representing the earth? (Answered)


1496. The supermarket tabloids report that a person fell 130ft from a bldg. He landed on a ventilator box which was crushed 18.7 in. Use a coordinate system with down being + to answer. What is his speed (m/s) before colliding with the box? What is his acceleration (m/s/s) while crushing the box (assume constant acc.)? How long did it take (ms) for him to come to a stop after first contacting the box? (Answered)


1508. A rancher sits on a tree limb and drops vertically onto a galloping horse under the tree. The speed of the horse in 9.28m/s and the distance from the limb to the saddle is 3.23m. What must be the horizontal distance in m between the saddle and the limb when the rancher drops and how long (s) is he in the air? (Answered)


1536. evaluate arccot(1/sqrt3) (Answered)


1541. A bag has total 40 coins of 1,2 and 5 unit denominations. If total amount value of coins is 140 then find the number of coins. (Answered)


1575. Air is being pumped into a spherical balloon at a rate of 5cm^3/min. Determine the rate at which the radius of the balloon is increasing when the diameter is 18cm. (Answered)


1583. CACAGCACCCCAGCACGACAAAGGGCCCCC

I need to write the 10 amino acid long sequence that this strand of DNA codes for, as shown above. I have to use three letter code for amino acid sequence. (Answered)


1596. Help me solve this alegbra problem:
((1)/(x-5)) +10=((x)/(x-5)) (Answered)


1643. write a general linear equation for the line that passes through the points (1,1) and (2,1). (Answered)


1713. let f(x)=(2x-pi) ^3 +2x-cosx. the value of modulus of d/dx of f inverse of x when x= pi is (Answered)


1722. X^3 - x^2 lessthan equal to 1 (Answered)


1722. X^3 - x^2 lessthan equal to 1 (Answered)


1738. Solve for x (x-7)^4/3=1 (Answered)


1741. Prove that the equation has at least one real root and use your calculator to find an interval of length .01 that contains a root.
E^x=2-x
(Answered)


1752. The diagram shows the gears of a bicycle. AD = 5 inches, and BC = 3 inches. CD, the length of the chain between the gears, is 17 inches. What type of quadrilateral is CDEB? (Answered)


1763. Determine whether the function f(x)=-x^2-4x+4 has a maximum and minimum
(Answered)


1782. 2/3 of 1/6 of 3/4 of a number is 12 (Answered)


1788. (x+7)(x-1)=(x+1)^2 how to solve (Answered)


1843. Identify the center and radius

-6x+y^2=-x^2-146+2y(square root of 141) (Answered)


1840. The line through (-10, 2) which is perpendicular to the line y=8x+9 has slope -1/8 and a y-intercept __? (Answered)


1850. (2+x)^2-8/x (Answered)


1873. what is 3[f(x+2)] if f(x)=x^3+2x^2-4? (Answered)


1947. If x^2 y^2=2, find an expression for y. (Answered)


1967. Help me solve this math problem:
5/x-3 - 2/x^2-9 (Answered)


1972. lim (3x+2)/(4x) as x approaches infinity (Answered)


1982. Lim approaches infinity. The square root of x+9-3, all divided by x (Answered)


1985. how to prove that the integral (lnx)^n [eval @ 0 to 1] equal (-1)^n*! (Answered)


2008. x^2+x-20>0

I need help find solution set for the linear inequalities. (Answered)


2010. If the manager of a store adds 50 lamps to its current inventory, the resulting total number of lamps will be the same as three-halves of the current inventory. if the manager wanted to increase the current inventory by 40%, what would his new inventory of lamps be ? (Answered)


2017. differentiate y=2x/1-3x^2 (Answered)


2027. 4^(x^2-10x+25)=1 (Answered)


2027. 4^(x^2-10x+25)=1 (Answered)


2074. Les drives 4 miles each way to work at an average of $0.195 per mile. He pays $2.25 a day to park and works an average of 24 days per month. What is his average monthly cost? (Answered)


2081. What is the period that corresponds to a
frequency of 53.1 Hz?
Answer in units of s (Answered)


2091. If the line 3x-4y=0 is tangent in the first quadrant to the curve y=x^3+k, then k is (Answered)


2092. The derivitive of (x)times the square root of (x^2 +1) (Answered)


2097. My question is Evaluate limit of x as it approaches 2,x^1560-2^1560 divided by x-2, using the defintion of the derivative for an appropriate function (Answered)


2115. How to do rational equations and radical equations (Answered)


2133. Help me understand this Calculus problem: When an object is placed at a distance p
from a convex lens having focal length 6 cms, then the image will be at a distance q from the lens while
1/6=1/p+1/q.
Find the rate of change of p with respect to q. (Answered)


2133. Help me understand this Calculus problem: When an object is placed at a distance p
from a convex lens having focal length 6 cms, then the image will be at a distance q from the lens while
1/6=1/p+1/q.
Find the rate of change of p with respect to q. (Answered)


2145. Find the root of X^2-19x-42 (Answered)


2292. How many grams of calcium flouride are in 800mL of a 0.62 M calcium flouride solution? (Answered)


2317. find a polynomial of degree n that has the given zeros x=-2,4,7 n=3
(Answered)


2382. A particle moving along the curve 16x^2+9y^2=144 find all points which the rate of change of y and x are equal. Assure these rates are never both zero at the same time (Answered)


2409. Help me find all open intervals on which the function f(x) = x to the second power over x to the second power plus 4 (Answered)


2489. Need help performing a statistical hypothesis test (Answered)


2489. Need help performing a statistical hypothesis test (Answered)


2561. y==200sin(6t-1.2)mm where the angles are in radians. What is the period of oscillation? The initial value of y (when t=0) and the value of t at which y reaches 50mm? (Answered)


2566. (5.9x^3+3.4^2-7)-(2.9x^3-9.6x^2+3) (Answered)


2593. A fair coin is tossed five times. Find the probability of obtaining one head and three tails. (Answered)


2593. A fair coin is tossed five times. Find the probability of obtaining one head and three tails. (Answered)


2639. explain me how to use multinomial theorem in detail in the chapter permutations and combinations(how diff questions can be solved by it?) (Answered)


2714. FIND THE SUM in normalised floating print representation

0.215642E04 + 0.146521E05 + 0.233416E06 (Answered)


2714. FIND THE SUM in normalised floating print representation

0.215642E04 + 0.146521E05 + 0.233416E06 (Answered)


2714. FIND THE SUM in normalised floating print representation

0.215642E04 + 0.146521E05 + 0.233416E06 (Answered)


2714. FIND THE SUM in normalised floating print representation

0.215642E04 + 0.146521E05 + 0.233416E06 (Answered)


2714. FIND THE SUM in normalised floating print representation

0.215642E04 + 0.146521E05 + 0.233416E06 (Answered)


2720. y=x2 how to find tangent line with points (-4,16) (Answered)


2725. According to the Current Population Survey of the Census Bureau, 67% of children live with both parents, 23% live with their mother only, and 5% live with their father only. The rest live with neither parent. If we choose a child at random, what is the probability that the child lives with only ONE parent (father OR mother)? (Answered)


2734. Traffic flow is defined as the rate at which cars pass through an intersection, measured in cars per minute. The traffic flow at a particular intersection is modeled by the function F... F(t)= 82 + 4sin(t/2) for 0 < t < 30... A) to the nearest whole number, how many cars pass through the intersection over the 30 min period?
b) is the traffic flow increasing or decreasing at t=7
c) what is the average value of the traffic flow over the time interval 10 < t < 15?
d) what is the avg rate of change of the traffic flow over the time interval 10 < t <15?
(Answered)


2745. Find the slope of the tangent on this curve?

y=x^2-3x at the point (2, -2)
Using the formula
m= lim h->0 = [f(x+h)-f(x)]/h (Answered)


2765. Please help find sin2x for secx = -5, for pi < x < 3pi/2 (Answered)


2769. If m<1 + m<5 = 100

Find the measure of m<8 (Answered)


2781. Find the area of a circle with radius 19.4 m to the nearest tenth. Use 3.14 for Pi. (Answered)


2820. You invest 5000 in an account which pays interest compounded continuously.
If you want the account to contain 8000 after 6 years, what yearly interest rate is needed?

Round your answer to one decimal place.

(Answered)


2829. Find the lim as x aproaches delta (D) x of: (x+Dx)^2-2(X+Dx)-(X^2-2x)? (Answered)


2907. For a sample of measurements x-bar = 10m, median = 13m standard deviation = 4m and sample variance = 16m^2

a) if the data is changed to centimeters (i.e. yi=100xi) then find the new set of measurements

Here, I just multiplied all of the above answers by 100, and assumed that that was correct BUT, if I use that logic for part b, it starts to get confusing...

b) IF the data is transformed to yi=(xi-10)/4 find the new measurements

... if I try to do the same thing (sub the x measurements into the new formula) I end up with an average length of 0, which makes no sense to me, and makes me think that I must be doing something wrong!
(Answered)


2914. 4(negative3x+1)=negative10(x-4)-14x (Answered)


2923. The Oliver Company plans to market a new product. Based on its market studies, Oliver estimates that it can sell up to 4,600 units in 2005. The selling price will be $2 per unit. Variable costs are estimated to be 20% of total revenue. Fixed costs are estimated to be $6,600 for 2005. How many units should the company sell to break even? (Answered)


2938. (inverse sin) sin power -1 (-1/2) exact value (Answered)


3008. What is integration? (Answered)


3008. What is integration? (Answered)


3095. Three freshmen and three sophomores are to be seated in a row. Find the number of seating arrangements if the freshmen are on the left and the sophmores are on the right. (Answered)


3115. I need help simplifying the expression 1-2cos^2x+cos^4x (Answered)


3122. 9x^2+36x+y^2-6y+9=0
help solve please (Answered)


3156. Write the equation of the circle that has a center at the origin and is tangent to the line with the equation 3x - 4y = 10? (Answered)


3161. Help me solve this problem
csc*cos^2/1+csc (Answered)


3193. How do I factor: sec^4x+sec^2xtan^2x-2tan^4x? (Answered)


3215. help me solve this math problem: determine whethe the mean value theorem can be applied to the function f(x)=2sinx+sin2x on the closed interval [8pi,9pi]. (Answered)


3207. find the exact value: (tan 325 - tan 25)/(1+ tan325tan25) (Answered)


3236. a) Research the space elevator and describe how the rotation of the earth prevents the cable from falling to its attachment point at the earth's equator.

b) Consider the environment in which the cable must operate. Recommend two
physical, and one chemical property that the cable should have. Justify your
choices.

c) Based on what you have learned about bonding in solids, which type of solid, in your opinion, is the most suitable for use in the space elevator cable? Justify your choice.

d) Research which technical hurdles must be overcome before your choice in (c) can be used for the elevator cable.
(Answered)


3249. The product of two positive numbers is 588. Minimize the sum of the first and three times the second. (Answered)


3271. The length of a rectangle sign is 3 feet longer than the width. If the sign area is 54 square feet, find it length and width. (Answered)


3320. Suppose that f is a linear function with slope 2.4 and that f(7)=-3. What value of x gives f(x)=0? (Answered)


3360. A particle moves up and down the y-axis with velocity v feet per second given by v=t3 -7t2 +15t - 9 during the time interval [0,4]. At time t=0, its position is y=4.

At what time(s) is the particle stopped?

At what time is is the velocity the absolute maximum? The absolute minimum?

At what time(s) does the velocity-time graph have a point of inflection>

What is happening to the particle at the point(s) of inflection?

Find the position, y, as a function of time.

At what time is the position the absolute maximum? The absolute minimum?

At what time(s) does the position-time graph have a point of inflection?

What is happening to the particle at the point(s) on inflection?

Is y ever negative? (explain)

What is the net displacement of the particle from t=0 to t=4?

How far does the particle travel from t=0 to t=4?

What is the average velocity from t=0 to t=4?

What is the average speed from t=0 to t=4? (Answered)


3370. determine an equation of the line tangent to the graph of f at (a,f(a) for the given value of a. F(x)=x^3 a=-1 (Answered)


3379. Test for convergence or divergence using the geometric series test for the sum of 5(-1/5)^n from n=0 to infinity. (Answered)


3379. Test for convergence or divergence using the geometric series test for the sum of 5(-1/5)^n from n=0 to infinity. (Answered)


3387. If a package of lables costs $25.00 and there are 1250 lables in the package, how much would 20 lables cost? (Answered)


3387. If a package of lables costs $25.00 and there are 1250 lables in the package, how much would 20 lables cost? (Answered)


3427. A light string of length a is attached to two points A and B on the same level and distance b apart, where b < a. A smooth ring of weight W is threaded on the string and is pulled by a horizontal force P, so that it rests in equilbrium vertically below B. Show that tension in the strings is W(a^2 + b^2)/2a^2 and find the force P (Answered)


3446. Together, two workers can complete a job in 8 hours. The first worker can complete the job 4 times faster than the second worker. How long would it take the faster worker to do the job alone? (Answered)


3478. It was proven during the previous lecture that
1+2+3+....+n=[n(n+1)]/2.

Using that result, find the sum of all 3-digit palindromes: a palindrome is a number that can be written as ABA, where 1=(Answered)


3502. divide f(x) by d(x) in polynomial form and fraction form if f(x)=x2-2x+3; d(x)=x-1 (Answered)


3506. you roll two fair dice, a green one and a read one.
1.are the outcomes on the dice independent?
2.find the P(1 on a green dice and 2 on red dice)
3. find p(3 on green dice and 5 on red dice)
4. find p(3 on green dice and 5 on red dice) or (2 on green dice and 1 on red one) (Answered)


3517. The whole is 5000 and the part is 10. Find the percent. (Answered)


3562. find an equation for the hyperbola vertices (3,0),(3,4) asymptotes:y=2/3,y=4-2/3x (Answered)


3596. A commercial jet is flying from Miami to Seattle. The jet's velocity with respect to the air is 580 miles/hour and its bearing is 332 degrees. The wind, at the altitude of the plane is blowing from the southwest with a velocity of 60 miles/hour.
a) Draw a figure that gives a visual representation of the situation.
b) Write the velocity of the wind as a vector in component form.
c) Write the velocity of the jet relative to the air in component form.
d) What is the speed of the jet with respect to the ground?
e) What is the true direction of the jet?
(Answered)


3617. Intergration Problem:

d/dx (1-3x to 1 u^3/1+u^2 du ) (Answered)


3622. Draw a Venn diagram that includes regions that show these 6 classes of numbers and the overlaps among them :
* Odd numbers
*2-digit numbers
*3 dight numbers
*intergers
*rational numbers
*perfect squares (like 100, which is 10*10 )

place the following 13 numbers on your venn diagram in their correct places:
3/4, 15,28,36,81,363,441,484,500,1369,2500,5000,7777 (Answered)


3627. Help me understand this precalculus problem cos^2A (sec^2A-1) (Answered)


3647. consider the differential equation dy/dx=2x-y. Find (dy)^(2)/(dx)^(2) in terms of x and y. (Answered)


3676. help me solve this math problem

59n over 99 times 80 over 33n (Answered)


3718. 10h=8h+6 solve and check (Answered)


3801. I need some help with showing exponential growth on a graph and some other functions (Answered)


3847. help me solve this problem p(x)= 1/8(2x4+3x3-16x-24)2
(Answered)


3851. Combine like terms.

5b + 7 + 7b - 6 (Answered)


3972. A rectangle with an area of 800 sqft is enclosed in another rectangle with dimensions of 80ft x 60 ft. Each side of the inside rectangle is the same distance away from the outside rectangle. Find the distance from each side of the inside rectangle. (Answered)


4029. Help me solve this math problem: Find the perimeter of the ice skating rink with the given dimensions. (hint: Think of the rink as made up of 2 half-circles at the top and bottom of the rectangle.) (30m width, and 12m length.) Can you show ur work pls... (Answered)


4074. Consider this data sequence: \\\"fish bird reptile reptile bird bird bird mammal fish\\\". There is a CONSECUTIVE REPETITION of length 3 (the three consecutive birds) and a CONSECUTIVE REPETITION of length 2 (the two reptiles). There are also several SINGLETONs of length 1 (a singleton fish, a singleton bird, a singleton mammal, and another singleton fish).

Write some code that uses a loop to reads in a sequence of words, terminated by the \\\"xxxxx\\\". The code assigns to t the number of CONSECUTIVE REPETITIONS that were read. (For example, in the above data sequence that value would be 2.) Assume that t has already been declared but not initialized. Assume that there will be at least one word before the terminating \\\"xxxxx\\\".

(Answered)


4074. Consider this data sequence: \\\"fish bird reptile reptile bird bird bird mammal fish\\\". There is a CONSECUTIVE REPETITION of length 3 (the three consecutive birds) and a CONSECUTIVE REPETITION of length 2 (the two reptiles). There are also several SINGLETONs of length 1 (a singleton fish, a singleton bird, a singleton mammal, and another singleton fish).

Write some code that uses a loop to reads in a sequence of words, terminated by the \\\"xxxxx\\\". The code assigns to t the number of CONSECUTIVE REPETITIONS that were read. (For example, in the above data sequence that value would be 2.) Assume that t has already been declared but not initialized. Assume that there will be at least one word before the terminating \\\"xxxxx\\\".

(Answered)


4116. 15/x-1=24/2x (Answered)


4399. Graph: 5-2(x-6)^(1/3), for x doesnt equal 5

the limit of f(x) as x approaches 5 is equal to 7. write the definition of limit as it applies to f at this point. (Answered)


4500. correct this sentence. What you do not know, is that your son, Kiowa, has been killed in war. (Answered)


4538. f(x)=3x^2+2x-1,evaluate f(a+h)-f(a)/h (Answered)


4538. f(x)=3x^2+2x-1,evaluate f(a+h)-f(a)/h (Answered)


4570. A player kicks a football an angle 23 deg to the horizontal with a speed of 12.5m/s. The receiver runs towards the ball at a constant speed to just intercept the ball at ground level. How fast must he run? (Answered)


4570. A player kicks a football an angle 23 deg to the horizontal with a speed of 12.5m/s. The receiver runs towards the ball at a constant speed to just intercept the ball at ground level. How fast must he run? (Answered)


5203. Describe the structure of 3 named australian native terrestrial plants that assist in conserving water. (Answered)


5251. Answer the questions below regarding this polynomial: 8x + 2x^4 - 5x^3

1.) This expression, written in standard form, would look like this:

2.) This is a ___degree polynomial.

3.) The leading coefficient of this polynomial is ____ .
(Answered)


5352. I am having trouble finding the x intercept. I get the answer wrong. the question is:x^2-y^2+2x-3y+1=7 (Answered)


5384. How do I verify this equation?

(Answered)


5507. algebra
(Answered)


5544. Use the half-angle formula to simplify the expression: sqrt(1+cos 4x/1-cos 4x) (Answered)


5584. 1. What is the probability that in an arrangement of BUTTERED TOAST the O and A or the E and T are adjacent?

2. When drawing 4 marbles from out of a bag with 8 red and 4 blue, what is the probability that at least one blue and red is pulled? (No replacement)

3. A box has a group of 24 blocks in it. Some are red, some are yellow, and some are a mixture of the two colours. The probability of drawing a block with red on it is 1/3. The probability of drawing a red and yellow block is 1/12. Determine the number of blocks with yellow on them. (Answered)


5667. How do I reword this research question "Does Creative Commons solve the dilemma of reclaiming fair use within creative works that use copyrighted material?" (Answered)


5884. What did Lewis and Clark do that made them famous? (Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


0.
(Answered)


^ Back to Top ^