Recently Submitted Homework Problems: biology

128. A. The wings of a bat are homologous to whale fins, and they represent a structure evolving in an organism for a particular function but later being adapted for another function. This is an example of ___________.
here are the options
adaptation ,evolution ,exaptation ,radiation ,or speciation
B. Why are people trying to lose weight advised to include whole fruits and leafy vegetables in their diet?
here are the options
Because they are rich sources of energy and are sufficient to be eaten in small amounts , Because they are almost indigestible and low in nourishment , Because they are effective in cleaning up the digestive system by flushing out toxins , a and c , or b and c
C. ______________ is the sum of all the genetic information carried by the members of a population.
here are the options
Gene pool , Genetic drift, Genetic code, Genetic variation , or Genetic divergence
D- Photosynthesis is an example of __________.
here are the options
oxidation, hydrolysis, anabolism, catabolism , or carbohydrate breakdown
5- Presence of more than one genetically distinct populations of cells derived from more than one zygote is called __________.
here are the options
translocation ,mosaicism ,duplication , chimerism, or recombination
D.Chihuahuas and Great Danes, two dog species, cannot interbreed because their copulatory organs are not compatible. This is an example of __________ isolation.
A.
mechanical
B.
temporal
C.
habitat
D.
gametic
E.
behavioral

F. On staining an onion root section, a scientist found that many of the cells had highly condensed chromosomes aligned along the middle of the cell. This means that the majority of the cells were in the __________.
A.
anaphase
B.
metaphase
C.
prophase
D.
interphase
E.
telophase

8. _________________ is a type of postzygotic barrier in which hybrids of two species reach maturity but are sterile.
A.
Hybrid sterility
B.
Hybrid inviability
C.
Gametic isolation
D.
Hybrid breakdown
E.http://www.schooltrainer.com/free-homework-help.html#
Behavioral isolation

(Answered)


219. I would like to know what enzyme is used in the treatment of a cell in somatic fusion and what name is given to it after the treatment?(Answered)


1309. What ethical issues might arise when a drug company funds trials of a new drug it has developed to treat a genetic disorder? (Answered)


1583. CACAGCACCCCAGCACGACAAAGGGCCCCC

I need to write the 10 amino acid long sequence that this strand of DNA codes for, as shown above. I have to use three letter code for amino acid sequence.(Answered)


2146. Do the positive charges of calcium ions and sodium ions make these ions more likely to move into or out of a cell? (Answered)


3903. help me solve these seven biology questions!!! its due tomorrow!(Answered)


3904. please help with this question: what is evolution?(Answered)


4087. which types of cells and organisms undergo mitosis and meiosis?(Answered)


4226. i have problem in bio please tell me the difference between fungi and algea(Answered)


4226. i have problem in bio please tell me the difference between fungi and algea(Answered)


4278. What organism requires energy, but not from the sun?(Answered)


4340. What are unicellular and multicellular organisms?(Answered)


4444. If T is a genetic trait for tallness, and its alleles TT,tT,Tt, and tt, how many of these children will be tall?(Answered)


4445. Charles Darwin is considered a pioneer in the study of child psychology because he ______?(Answered)


4956. what do tears actually contain?(Answered)


5051. What organic molecules make up the cell membrane? (Answered)


5203. Describe the structure of 3 named australian native terrestrial plants that assist in conserving water.(Answered)


5474. A person's heartbeat and breathing increases after he finished the race. After some time his heartbeat and breathing becomes normal. Which two components of nervous system does it? How?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


0. a person's heartbeat and breathing increases after he finished the race. after some time his heartbeat and breathing becomes normal. which two
components of nervous system does it? how?
(Answered)


5689. General Biology Help
1. The neurotransmitter gamma-Aminobutyric acid (GABA) opens an ion channel that moves Cl-
in to the postsynaptic neuron. Would this be an excitatory or an inhibitory signal? Explain your answer



a. The medical condition known as Tentanus is caused by a neurotoxin called Tetanospasmin. This neurotoxin prevents neurons from releasing GABA. How would this affect the calcium concentration in the sarcoplasmic reticulum of a muscle cell?


b. Tetanus affects both of the antagonistic muscles equally. Predict a symptom of tetanus.





2. A woman fluent in sign language suffers an injury which severed the corpus callosum. After he injury the woman can still understand signs but could not generate signs that represent her thoughts. What might explain these findings?



3. Suppose that a person with damage to the hippocampus is unable to acquire new long term memories. Why might the acquisition of short term memories also be impaired?
(Answered)


5724. Blind spot.
What is the blind spot of the eye? Explain it.(Answered)


^ Back to Top ^